First Report of Potato Mop-Top Virus on potato ( Solanum tuberosum ) in Italy
Antonio Tiberini, Livia Donati, Ariana Manglii, Salvatore Vitale, Laura Luongo, Laura TomassoliPotato mop-top virus (PMTV, Pomovirus solani) affects tuber quality and reduces potato (Solanum tuberosum L.) yield. First described in Northern Ireland and England in 1966, its origin is thought to be northern South America. PMTV is now reported in all potato-growing continents (Falloon et al., 2024). In Europe, it occurs mainly in northern and central regions where cool, humid conditions favor its establishment. PMTV is included among pests recommended for testing in the EPPO seed potato certification scheme (EPPO, 2023). The virus is transmitted by Spongospora subterranea, the causal agent of powdery scab, whose resting spores enable long-term survival in soil. Infected tubers typically show internal brown necrotic arcs or rings, while external symptoms are often absent. Since 2021, surveys on potato diseases have been conducted in the “Altopiano della Sila” production area (about 2,000 ha) in Calabria, southern Italy, including fields and packing facilities. In the latter, in October 2025, a tuber showing a necrotic ring was found among discarded ware potatoes (cv. Nicola) (Figure 1a) delivered to the warehouse by a local producer; five asymptomatic tubers from the same lot were also collected. ELISA tests (Bioreba AG, Switzerland) were negative for potato virus Y (PVY), although PVY Wilga and NTN strains are endemic in the area (Manglli et al., 2026). Inspection of tuber tissue revealed mild spraing symptoms (Figure 1b,c), prompting PMTV testing. Total RNA was extracted using the RNeasy Plant Mini Kit (Qiagen). PMTV was detected by end-point RT-PCR targeting RNA3 (Mayo et al., 1996) and RNA2 (Sokmen et al., 1998) following Eyre Rowles-van Rijswijk et al. (2020). All six tubers tested positive. An RNA3 amplicon was Sanger sequenced (Eurofins, Germany), yielding a full-length coat protein (CP) sequence (GenBank Acc. No. PZ055794). BLASTn analysis showed >99% nucleotide identity with over 100 PMTV isolates, including one from Maryland, USA (KY284863). Phylogenetic analysis using maximum likelihood with 1000 bootstrap replicates in MEGA X (Kumar et al., 2018) clustered the Italian isolate with American and northern European isolates, including those from Finland and Sweden (Figure 2). Based on the Sila isolate sequence, a new primer pair (PMTV_18F: TGAAAACAGAGGTGAGCGAAG; PMTV_426R: CACATTCAGAGCGCTATCCTC, 46 °C at 30 min, 95 °C at 5 min, 35 cycles (1 min at 94 °C, 30 sec at 60 °C, 45 sec at 72 °C), final 10 min at 72 °C)) targeting the CP gene was designed, producing a 406 bp amplicon. Screening of 100 tubers from the same ‘Nicola’ lot detected PMTV in 20% of samples. No powdery scab symptoms were observed. Six additional ware potato lots from the Sila area (100 tubers each) tested negative. During five years of surveys, no PMTV-like symptoms had been observed in fields or harvested tubers. However, in the same 2025 survey, tubers from a ‘Fontane’ lot were infected by S. subterranea (Figure 3), although neither tubers nor sporosori tested positive for PMTV. To our knowledge, this is the first report of PMTV in Italy. Ware potato production is economically important for the Italian agricultural sector, particularly in Calabria, where the PGI “Patata della Sila” is cultivated. Conversely, Italy largely depends on seed potato imports from northern Europe, mainly France, the Netherlands and Germany. Further investigations are underway to determine the introduction pathway and assess the occurrence of PMTV and S. subterranea in affected farms and throughout the Sila plateau.