DOI: 10.1002/ps.71450 ISSN: 1526-498X

Ala‐205‐met mutation in acetolactate synthase ( ALS ) of Bromus japonicus confers resistance to

Jingyi Xu, Bingbo Guo, Binghua Li, Zhizun Qi, Xiaomin Liu, Guiqi Wang, Silong Chen, Xian Xu
Show PDF Cite

Abstract

BACKGROUND

Acetolactate synthase (ALS)‐inhibitor‐resistant Bromus japonicus populations are widespread in wheat fields in China. A novel population BD‐R has evolved resistance to flucarbazone–sodium, whereas its underlying resistance mechanism remains unclear. The objectives of this study were to (i) determine the resistance and cross‐resistance levels to ALS inhibitors; (ii) investigate the resistance mechanisms; (iii) evaluate response to herbicides with other modes of action; and (iv) develop a CAPS molecular marker for rapid resistance detection.

RESULTS

The resistant index (RI) value of BD‐R to flucarbazone‐sodium was 62.4, and the cross RI values to mesosulfuron‐methyl and pyroxsulam were 62.5 and 142.4. A novel Ala‐205‐Met substitution was found in BD‐R. ALS activity bioassays showed the I 50 values of BD‐R and HS‐S to flucarbazone‐sodium were 7753.82 and 144.12 n

m
. 3D modelling and molecular docking results revealed the Ala‐205‐Met mutation reduced the binding affinity between ALS and the three ALS inhibitors. Homozygous transgenic Arabidopsis thaliana lines harboring ALS from BD‐R exhibited resistance to flucarbazone‐sodium, with FW inhibition merely 4.93%. Haloxyfop‐P‐methyl and quizalofop‐P‐ethyl showed excellent control of BD‐R, whereas topramezone and mesotrione exhibited no efficacy. A CAPS‐ ALS marker with the primers CAPS‐ALS‐F (5'‐TCATCACCAACCATCTCTTCC‐3′) and CAPS‐ALS‐R (5'‐ATCAGAGTAGTTGTAACTGGAATC‐3′) was developed and could reliably identify the resistant BD‐R plants.

CONCLUSION

BD‐R conferred high‐level resistance and cross‐resistance levels to ALS‐inhibitors. Haloxyfop‐P‐methyl and quizalofop‐P‐ethyl can be used for effective control BD‐R. This study is the first report of the Ala‐205‐Met mutation conferring resistance to ALS inhibitors in weeds, indicating the complexity of the evolution of herbicide resistance in weeds. © 2026 Society of Chemical Industry.

More from our Archive